Sequenciamento Shotgun: diferenças entre revisões
Conteúdo apagado Conteúdo adicionado
Linha 27:
| doi = 10.1093/nar/9.13.3015
| pmc = 327328}}</ref>
o DNA é dividido aleatoriamente em numerosos pequenos segmentos, que são sequenciados utilizando o [[Método de Sanger|método de terminação de cadeia]] para obter ''leituras''. Múltiplas leituras sobrepostas para o DNA-alvo são obtidas através da realização de várias rodadas desta fragmentação, e seqüenciamento.
O sequenciamento Shotgun foi uma das tecnologias precursoras que foi responsável por possibilitar o [[seqüenciamento do genoma completo]].
==
Por exemplo, considere os seguintes duas rodadas de leituras shotgun:
{| class="wikitable"
|-
!
! Sequência
|-
| Original
| <code><big>AGCATGCTGCAGTCATGCTTAGGCTA</big></code>
|-
| Primeira sequência shotgun
| <code><big>AGCATGCTGCAGTCATGCT-------</big></code><br/><code><big>-------------------TAGGCTA</big></code>
|-
|
| <code><big>AGCATG--------------------</big></code><br/><code><big>------CTGCAGTCATGCTTAGGCTA</big></code>
|-
| Reconstrução
| <code><big>AGCATGCTGCAGTCATGCTTAGGCTA</big></code>
|}
<!--
In this extremely simplified example, none of the reads cover the full length of the original sequence, but the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally complicated by the great abundance of [[Repeated sequence (DNA)|repetitive sequences]], meaning similar short reads could come from completely different parts of the sequence.
| |||