Abrir menu principal

Haplogrupo R1b (ADN-Y)

Haplogrupo R1b (Y-DNA) é a linhagem paterna dominante da Europa Ocidental. Em genética humana o haplogrupo R1b é o mais frequente haplogrupo do cromossomo Y na Europa Ocidental e em partes da África sub-saariana Central (por exemplo em torno de Chad e Camarões). R1b também está presente em freqüências mais baixas em toda a Europa Oriental, Ásia Ocidental, Ásia Central e partes do norte da África, Sul da Ásia e Sibéria. Devido à emigração Europeia também atinge altas frequências nas Américas e na Austrália. Enquanto a Europa ocidental é dominada pela R1b1a2 ramo (R-M269) de R1b, a área de língua Chadic na África é dominada pelo ramo conhecido como R1b1c (R-V88). Estes representam dois "galhos" muito bem sucedidos em uma muito maior "árvore genealógica".[3][4][5][6][7]

Haplogrupo R1b

Haplogroup R1b (Y-DNA).PNG

Tempo de origem < 18,500 anos[1]
Lugar de origem Sudoeste Asiático[2]
Ancestral R1
Descendentes R1b1a (R-P297), R1b1b (R-M335), R1b1c (R-V88)
Mutações definidas M343
Alta frequência Europa ocidental, Norte dos Camarões, Bashkires

FundamentosEditar

O haplogrupo R1b é definido pelo marcador genético, M343 anunciado em 2004,[8] o qual define um polimorfismo binário específico no cromossomo Y. É agora definido como o haplogrupo R1b do cromossomo Y (anteriormente conhecido como Hg1 e Eu18).[9] Este marcador genético é portado pela maioria dos Europeus Ocidentais. É portado por 60% da população inteira de Portugal e de França, 70% da população inteira da Inglaterra e 90% de algumas partes de Espanha e Irlanda.

Três estudos genéticos recentes, de 2015, deram apoio à teoria de Marija Gimbutas de que a difusão das línguas indo-europeias teria se dado a partir das estepes russas (hipótese Kurgan). De acordo com esses estudos, o Haplogrupo R1b (ADN-Y) e o Haplogrupo R1a (ADN-Y) - hoje os mais comuns na Europa e sendo o R1a frequente também no subcontinente indiano - teriam se difundido, a partir das estepes russas, junto com as línguas indo-europeias; tendo sido detectado, também, um componente autossômico presente nos europeus de hoje que não era presente nos europeus do Neolítico, e que teria sido introduzido a partir das estepes, junto com as linhagens paternas (haplogrupo paterno) R1b e R1a, assim como com as línguas indo-europeias.[10][11][12]

Trabalhos de arqueologia contemporâneos associam a domesticação do cavalo a essa expansão.[13]

Os detalhes técnicos do M343 são:

  • Mudança de nucleotídeo: C a A
  • Posição (par de bases): 402
  • Tamanho total (pares de bases): 424
  • Forward 5′→3′: tttaacctcctccagctctgca
  • Reverse 5′→3′: acccccacatatctccagg

Isto refere-se a um particular fragmento de DNA de pares de bases que a reação em cadeia da polimerase produz quando um usa as duas cadeias "primárias" listadas.

M343 foi anunciado em um grupo de 21 novos marcadores do cromossomo Y em um artigo de Cengiz Cinniolu em conjunto com outros autores[14] e tem sempre sido usado em aplicações tais como o Projeto Genográfico. Note-se que M343 e M242 foram os únicos dois marcadores deste artigo usados por tal projeto.

Ver tambémEditar

Ligações externasEditar

Referências

  1. Karafet, TM; Mendez, FL; Meilerman, MB; Underhill, PA; Zegura, SL; Hammer, MF (2008). «New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree». Genome Research. 18 (5): 830–8. PMC 2336805 . PMID 18385274. doi:10.1101/gr.7172008 
  2. International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades
  3. Massive migration from the steppe is a source for Indo-European languages in Europe, Haak et al, 2015
  4. Population genomics of Bronze Age Eurasia, Allentoft et al, 2015
  5. Eight thousand years of natural selection in Europe, Mathieson et al, 2015
  6. Lara M. Cassidy; et al. (2016). «Neolithic and Bronze Age migration to Ireland and establishment of the insular Atlantic genome». PNAS. 113 (2): 368–373. Bibcode:2016PNAS..113..368C. doi:10.1073/pnas.1518445113 
  7. Rui Martiniano; et al. (2017). «The population genomics of archaeological transition in west Iberia: Investigation of ancient substructure using imputation and haplotype-based methods». PLoS Genet. 13 (7). doi:10.1371/journal.pgen.1006852 
  8. Cinnioğlu, Cengiz; et al (janeiro de 2004). «Excavating Y-chromosome haplotype strata in Anatolia». Human Genetics. 114 (2): 127-148. doi:10.1007/s00439-003-1031-4 
  9. Y Chromosome Consortium (18 de janeiro de 2002). «YCC NRY Tree 2002». Consultado em 13 de dezembro de 2007. Arquivado do original em 17 de dezembro de 2007 
  10. Haak; et al. (2015). «Migração em massa da estepe é fonte das línguas indo-europeias na Europa» (pdf publicado=2015) (em inglês). 172 páginas. Consultado em 6 de novembro de 2015 
  11. Allentoft; et al. (2015). «Genética de populações da Eurásia à época da Idade do Bronze» (pdf publicado=2015) (em inglês). 167 páginas. Consultado em 6 de novembro de 2015 
  12. Mathieson; et al. (2015). «8000 anos de seleção natural na Europa» (pdf publicado=2015) (em inglês). 167 páginas. Consultado em 6 de novembro de 2015 
  13. O cavalo, a roda e a linguagem Como cavaleiros das estepes euroasiáticas, da Idade do Bronze, contribuíram para a formação do mundo moderno, por David W. Anthony, Editora Universidade de Princeton, "The Horse, the Wheel and Language, How Bronze-Age Riders from the Eurasian Steppes shaped the Modern World", 2007
  14. Cengiz Cinniolu, et al.; Excavating Y-chromosome haplotype strata in Anatolia; Human Genetics; Volume 114, Number 2; January 2004, Pages: 127 - 148
  Este artigo sobre Genética é um esboço. Você pode ajudar a Wikipédia expandindo-o.